1<!DOCTYPE html> 2<html> 3 4 <head> 5 <meta charset="utf-8"> 6 <meta http-equiv="X-UA-Compatible" content="IE=edge"> 7 <meta name="viewport" content="width=device-width, initial-scale=1"> 8 <title>VS ribozyme</title> 9 <meta name="description" content="Rfam ID:na "> 10 <!--<link rel="stylesheet" href="http://localhost:4000/css/main.css>--> 11 <link rel="stylesheet" href="https://www.ribocentre.org/css/main.css"> 12 <!--link rel="canonical" href="http://localhost:4000/ribozyme/2022/04/19/VS-ribozyme.html"--> 13 <link rel="shortcut icon" type ="image/x-icon" href="https://www.ribocentre.org/images/favicon.ico"> 14</head> 15 16 17 <body> 18 19 <!--div class="navbar navbar-default navbar-fixed-top" role="navigation"> 20 <style> 21 /* Modify the background color https://www.color-hex.com/color-palette/1011604 */ 22 .navbar { 23 background-color: #0874c4; 24 } 25 .navbar .navbar-brand, 26 .navbar .navbar-text { 27 color: #eeeeee; 28 } 29 30 #now a{ 31 color:#fff 32 33 } 34 #now a:hover{ 35 font-size: 20px; 36 } 37 </style> 38 39 <div class="container-fluid"> 40 <div class="navbar-header"> 41 <button type="button" class="navbar-toggle collapsed" data-toggle="collapse" data-target="#navbar-collapse-1" aria-expanded="false"> 42 <span class="sr-only">Toggle navigation</span> 43 <span class="icon-bar"></span> 44 <span class="icon-bar"></span> 45 <span class="icon-bar"></span> 46 </button> 47 48 <a class="navbar-brand" href="https://www.ribocentre.org/"> 49 50 51 <img class="navbar-brand" src="https://www.ribocentre.org/images/Ribo_centre_logo.jpg" style='height:50px;margin-top:-14px;margin-bottom:0;padding:0;' alt="logo"> 52 Ribocentre 53 </a> 54 </div> 55 <div class="collapse navbar-collapse" id="navbar-collapse-1"> 56 <ul class="nav navbar-nav navbar-right"> 57 <li id="now"><a href="https://www.ribocentre.org/">Home</a></li> 58 <li id="now"><a href="https://www.ribocentre.org/ribozyme">Ribozymes</a></li> 59 <li id="now"><a href="https://www.ribocentre.org/sequence">Sequences</a></li> 60 <li id="now"><a href="https://www.ribocentre.org/structure">
60Structures</a></li> 61 <li id="now"><a href="https://www.ribocentre.org/catalysis">Catalysis</a></li> 62 <li id="now"><a href="https://www.ribocentre.org/application">Applications</a></li> 63 <li id="now"><a href="https://www.ribocentre.org/publications">Publications</a></li> 64 <li id="now"><a href="https://www.ribocentre.org/Helps">Help</a></li> 65 </ul> 66 </div> 67 </div> 68</div--> 69 70<style> 71 .full-width-image { 72 width: 100%; 73 height: 350px; 74 overflow: hidden; 75 border-radius: 0; 76 margin-top: 0; 77 margin-bottom: 0; 78 position: relative; 79 background: url(../../images/homepicture.jpg) no-repeat; 80 background-size: cover; 81 background-position: center; 82 } 83 84 .full-width-image img { 85 width: 100%; 86 height: 100%; 87 object-fit: cover; 88 object-position: center 89 } 90 91 .search-box { 92 height: 100%; 93 width: 70%; 94 margin: 0 auto; 95 display: flex; 96 align-items: center 97 } 98 99 .search { 100 padding-top: 0px; 101 padding-bottom: 0px; 102 padding-left: 20px; 103 padding-right: 20px; 104 background: #fff; 105 position: absolute; 106 } 107 108 .search h2 { 109 font-size: 20px 110 } 111 112 .search .i { 113 display: flex; 114 align-items: center 115 } 116 117 .search .i img { 118 width: 70px; 119 height: 50px; 120 object-fit: contain 121 } 122 123 .search .i h1 { 124 font-size: 28px; 125 font-weight: 700; 126 margin-left: 10px 127 } 128 129 .search .tip { 130 font-size: 14px; 131 margin-top: 10px 132 } 133 134 .searchInput { 135 margin-top: 10px; 136 width: 450px; 137 height: 32px; 138 display: flex 139 } 140 141 .searchInput input { 142 flex: 1; 143 height: 100%; 144 line-height: 32px; 145 border: 1px solid #868686; 146 outline: 0; 147 border-radius: 7px; 148 padding: 0 10px 149 } 150 151 .gsc-control { 152 width: 300px; 153 } 154 155 .gsc-control div { 156 position: static; 157 } 158 159 /* Slight reset to make the preview have ample padding. */ 160 .gsc-control-cse { 161 padding: 1em; 162 } 163 164 .gsc-control-cse, 165 .gsc-control-cse .gsc-table-result { 166 width: auto; 167 font-family: Arial, sans-serif; 168 font-size: 13px; 169 } 170 171 .gsc-control-wrapper-cse { 172 width: 600px; 173 } 174 .gsc-search-button-v2, .gsc-search-button-v2:hover, .gsc-search-button-v2:focus { 175 border-color: #158CBA; 176 background-color: #158CBA; 177 background-image: none; 178 filter: none; 179 } 180 181 .gsc-control-cse, .gsc-control-cse .gsc-table-result { 182 width: auto; 183 font-family: Arial, sans-serif; 184 font-size: 1px; 185 } 186 .gsc-input { 187 font-size: 16px; 188 color: #000000; 189 } 190 .col-sm-4 { 191 padding-left: 0px; 192 padding-right: 26px; 193} 194input.gsc-input, .gsc-input-box, .gsc-input-box-hover, .gsc-input-box-focus { 195 border-color: #ffffff; 196} 197h1, .h1, h2, .h2, h3, .h3 { 198 margin-top: 22px; 199 margin-bottom: 0px; 200} 201img { 202 margin-bottom: 15px; 203 margin-top: 15px; 204 border-radius: 2%; 205} 206 </style> 207 208 209 210<div class="navbar-expand-lg navbar-dark" style='background-color: #333333; border-radius: 0; margin-bottom: 0; border: 0; height: 30px;' role="navigation"> 211 <div class="container-fluid" style='height: 30px; max-width: 1000px;'> 212 <ul class="nav navbar-nav navbar-right" style='height: 30px;'> 213 <li><a style='display: inline; padding: 15px 15px 5px 5px; line-height: 30px;' class="nav-link-0" href="https://www.gznl.org/"> 214 <img src="https://www.ribocentre.org/images/header/home.svg" style='height: 20px; width: auto; margin: 0;'> 215 Home</a></li> 216 <li><a style='display: inline; padding: 15px 15px 5px 5px; line-height: 30px;' class="nav-link-0" href="https://www.gznl.org/database/"> 217 <img src="https://www.ribocentre.org/images/header/database.svg" style='height: 20px; width: auto; margin: 0;'> 218 Database</a></li> 219 <li><a style='display: inline; padding: 15px 15px 5px 5px; line-height: 30px;' class="nav-link-0" href="https://www.gznl.org/research/"> 220 <img src="https://www.ribocentre.org/images/header/research.svg" style='height: 20px; width: auto; margin: 0;'> 221 Research</a></li> 222 <li><a style='display: inline; padding: 15px 15px 5px 5px; line-height: 30px;' class="nav-link-0" href="https://www.gznl.org/aboutus/"> 223 <img src="https://www.ribocentre.org/images/header/aboutus.svg" style='height: 20px; width: auto; margin: 0;'> 224 About us</a></li> 225 <li><a style='display: inline; padding: 15px 15px 5px 5px; line-height: 30px;' class="nav-link-0" href="https://gzlab.ac.cn/"> 226 GZNL-RDC 227 <img src="https://www.ribocentre.org/images/header/gznl2.svg" style='height: 20px; width: auto; margin: 0;'> 228 </a></li> 229 </ul> 230 </div> 231 </div> 232 233 234 <div class="full-width-image"> 235 <div class="search-box"> 236 <div class="search"> 237 <h2>GZNL's Respiratory Data Centre, GZNL-RDC</h2> 238 <div class="i"><img src="https://www.ribocentre.org/images/ribocentre.svg"> 239 <h1>Ribocentre</h1> 240 </div> 241 <p>A database of ribozymes</p> 242
242<script async src="https://cse.google.com/cse.js?cx=2dcb771063bc36a13"></script>
242 243 244 <div class="gcse-search"></div> 245 <p>Example: 246 <a href="https://www.ribocentre.org/search.html?q=rna#gsc.tab=0&gsc.q=rna&gsc.page=1" target="_blank">RNA</a> 247 <a href="https://www.ribocentre.org/search.html?q=Ribo#gsc.tab=0&gsc.q=Ribo&gsc.page=1" target="_blank">Ribo</a> 248 <a href="https://www.ribocentre.org/search.html?q=breaker#gsc.tab=0&gsc.q=breaker&gsc.page=1" target="_blank">Breaker</a> 249 <a href="https://www.ribocentre.org/ribozyme">Ribozymes</a> 250 <a href="https://www.ribocentre.org/publications">Publications</a> 251 <a href="https://www.ribocentre.org/docs/VS-ribozyme.html" target="_blank"> VS with 3D structures</a> 252 <a href="https://www.ribocentre.org/Helps">Teams</a> 253 </p> 254 </div> 255 </div> 256 </div> 257 258 259 <div class="navbar navbar-expand-lg navbar-dark bg-primary" style='border-radius: 0; border: 0;' role="navigation"> 260 261 <div class="container-fluid" style='max-width: 75%;'> 262 <div class="navbar-header"> 263 <button type="button" class="navbar-toggle collapsed" data-toggle="collapse" data-target="#navbar-collapse-1" aria-expanded="false"> 264 <span class="sr-only">Toggle navigation</span> 265 <span class="icon-bar"></span> 266 <span class="icon-bar"></span> 267 <span class="icon-bar"></span> 268 </button> 269 270 <a class="navbar-brand" href="https://www.ribocentre.org"> 271 272 <img class="navbar-brand" src="https://www.ribocentre.org/images/ribocentre-logo.svg" style='height:50px;margin-top:-14px;margin-bottom:0;padding:2px 2px;border-radius: 0;' alt="logo"> 273 <!--b style='font-size: 32px; color: #eeeeee;'>Ribocentre</b--> 274 </a> 275 </div> 276 <div class="collapse navbar-collapse" id="navbar-collapse-1"> 277 <ul class="nav navbar-nav navbar-right"> 278 <li><a class="nav-link-1" href="https://www.ribocentre.org/" style="font-size: 20px">Home</a></li> 279 <li><a class="nav-link-1" href="https://www.ribocentre.org/ribozyme" style="font-size: 20px">Ribozymes</a></li> 280 <li><a class="nav-link-1" href="https://www.ribocentre.org/sequence" style="font-size: 20px">Sequences</a></li> 281 <li><a class="nav-link-1" href="https://www.ribocentre.org/structure" style="font-size: 20px">Structures</a></li> 282 <li><a class="nav-link-1" href="https://www.ribocentre.org/catalysis" style="font-size: 20px">Catalysis</a></li> 283 <li><a class="nav-link-1" href="https://www.ribocentre.org/application" style="font-size: 20px">Applications</a></li> 284 <li><a class="nav-link-1" href="https://www.ribocentre.org/publications" style="font-size: 20px">Publications</a></li> 285 <li><a class="nav-link-1" href="https://www.ribocentre.org/Helps" style="font-size: 20px">Help</a></li> 286 </ul> 287 </div> 288 </div> 289 </div> 290 291 292 293 294 295 <div class="container-fluid"> 296 <div class="row"> 297 <article class="post" itemscope itemtype="http://schema.org/BlogPosting"> 298 299 <header class="post-header"> 300 <h1 class="post-title" itemprop="name headline">VS ribozyme</h1> 301 <p class="post-meta"><time datetime="2022-04-19T03:25:52+08:00" itemprop="datePublished">Apr 19, 2022</time> ⢠<span itemprop="author" itemscope itemtype="http://schema.org/Person"><span itemprop="name">Deng jie, Li mengxiao</span></span></p> 302 </header> 303 304 <div class="post-content" itemprop="articleBody"> 305 <p><strong>Rfam ID:na</strong> <br /></p> 306 307<h4 id="click-into-different-sections">click into different sections:</h4> 308 309<ul> 310 <li><a href="#timeline">Timeline</a></li> 311 <li><a href="#description">Description</a></li> 312 <li><a href="#structure">
312Structure and mechanism</a></li> 313 <li><a href="#references">References</a></li> 314</ul> 315 316<h2 id="timeline">Timeline</h2> 317 318<hr /> 319<html lang="zh-cn"> 320<head> 321 <meta charset="utf-8" /> 322 <meta name="viewport" content="width=device-width, initial-scale=1" /> 323 <meta http-equiv="X-UA-Compatible" content="IE=edge" /> 324 <title></title> 325 326</head> 327<style> 328 table { 329 border: 2px solid #f8f8ff; 330 border: 2px solid #767676; 331 border: 2px solid #767676; 332 border-radius: 5px; 333 background-color: #fff; 334 } 335.timeline { 336 list-style: none; 337 padding: 10px 0 10px; 338 position: relative; 339} 340.timeline:before { 341 top: 0; 342 bottom: 0; 343 position: absolute; 344 content: " "; 345 width: 3px; 346 background-color: #eeeeee; 347 left: 50%; 348 margin-left: -1.5px; 349} 350.timeline > li { 351 margin-bottom: 10px; 352 position: relative; 353} 354.timeline > li:before, 355.timeline > li:after { 356 content: " "; 357 display: table; 358} 359.timeline > li:after { 360 clear: both; 361} 362.timeline > li:before, 363.timeline > li:after { 364 content: " "; 365 display: table; 366} 367.timeline > li:after { 368 clear: both; 369} 370.timeline > li > .timeline-panel { 371 width: 46%; 372 float: left; 373 border: 1px solid #d4d4d4; 374 border-radius: 2px; 375 padding: 5px; 376 position: relative; 377 -webkit-box-shadow: 0 1px 6px rgba(0, 0, 0, 0.175); 378 box-shadow: 0 1px 6px rgba(0, 0, 0, 0.175); 379} 380.timeline > li > .timeline-panel:before { 381 position: absolute; 382 top: 16px; 383 right: -12px; 384 display: inline-block; 385 border-top: 10px solid transparent; 386 border-left: 10px solid #ccc; 387 border-right: 0 solid #ccc; 388 border-bottom: 10px solid transparent; 389 content: " "; 390} 391.timeline > li > .timeline-panel:after { 392 position: absolute; 393 top: 16px; 394 right: -10px; 395 display: inline-block; 396 border-top: 9px solid transparent; 397 border-left: 10px solid #fff; 398 border-right: 0 solid #fff; 399 border-bottom: 10px solid transparent; 400 content: " "; 401} 402.timeline > li > .timeline-badge { 403 color: #fff; 404 width: 25px; 405 height: 25px; 406 line-height: 40px; 407 font-size: 1.4em; 408 text-align: center; 409 position: absolute; 410 top: 16px; 411 left: 48.5%; 412 margin-left: 0px; 413 background-color: #999999; 414 z-index: 100; 415 border-top-right-radius: 50%; 416 border-top-left-radius: 50%; 417 border-bottom-right-radius: 50%; 418 border-bottom-left-radius: 50%; 419} 420.timeline > li.timeline-inverted > .timeline-panel { 421 float: right; 422} 423.timeline > li.timeline-inverted > .timeline-panel:before { 424 border-left-width: 0; 425 border-right-width: 15px; 426 left: -15px; 427 right: auto; 428} 429.timeline > li.timeline-inverted > .timeline-panel:after { 430 border-left-width: 0; 431 border-right-width: 14px; 432 left: -14px; 433 right: auto; 434} 435.timeline-badge.primary { 436 background-color: #2e6da4 !important; 437} 438.timeline-badge.success { 439 background-color: #3f903f !important; 440} 441.timeline-badge.warning { 442 background-color: #f0ad4e !important; 443} 444.timeline-badge.danger { 445 background-color: #d9534f !important; 446} 447.timeline-badge.info { 448 background-color: #5bc0de !important; 449} 450.timeline-title { 451 margin-top: 0; 452 color: inherit; 453} 454.timeline-body > p, 455.timeline-body > ul { 456 margin-bottom: 0; 457 padding-bottom: 0; 458} 459.timeline-body > p + p { 460 margin-top: 0px; 461} 462</style> 463 <ul class="timeline"> 464 <li> 465 <div class="timeline-badge warning"></div> 466 <div class="timeline-panel"> 467 <div class="timeline-heading"> 468 <h4 class="timeline-title"> <a href="https://www.ncbi.nlm.nih.gov/pubmed/2160856" target="_blank" style="font-size:25px;">1990</a> Discovery<sup>[1]</sup></h4> 469 </div> 470 </div> 471 </li> 472 <li class="timeline-inverted"> 473 <div class="timeline-badge primary"></div> 474 <div class="timeline-panel"> 475 <div class="timeline-heading"> 476 <h4 class="timeline-title"> <a href="https://www.ncbi.nlm.nih.gov/pubmed/7753865" target="_blank" style="font-size:25px;">1995</a> Secondary structure<sup>[2]</sup></h4> 477 </div> 478 <div class="timeline-body"> 479 </div> 480 </div> 481 </li> 482 <li> 483 <div class="timeline-badge warning"></div> 484 <div class="timeline-panel"> 485 <div class="timeline-heading"> 486 <h4 class="timeline-title"> <a href="https://www.ncbi.nlm.nih.gov/pubmed/11250907" target="_blank" style="font-size:25px;">2001</a> Importance of the 2-3-6 helical junction<sup>[3]</sup></h4> 487 </div> 488 </div> 489 </li> 490 <li class="timeline-inverted"> 491 <div class="timeline-badge primary"></div> 492 <div class="timeline-panel"> 493 <div class="timeline-heading"> 494 <h4 class="timeline-title"> <a href="https://www.ncbi.nlm.nih.gov/pubmed/11575922" target="_blank" style="font-size:25px;">2001</a> A730 loop is important<sup>[4]</sup></h4> 495 </div> 496 </div> 497 </li> 498 <li> 499 <div class="timeline-badge warning"></div> 500 <div class="timeline-panel"> 501 <div class="timeline-heading"> 502 <h4 class="timeline-title"> <a href="https://www.ncbi.nlm.nih.gov/pubmed/12368096" target="_blank" style="font-size:25px;">2002</a> A756 is critical for catalysis<sup>[7]</sup></h4> 503 </div> 504 </div> 505 </li> 506 <li class="timeline-inverted"> 507 <div class="timeline-badge primary"></div> 508 <div class="timeline-panel"> 509 <div class="timeline-heading"> 510 <h4 class="timeline-title"> <a href="https://www.ncbi.nlm.nih.gov/pubmed/17464286" target="_blank" style="font-size:25px;">2007</a> G638 is critical for catalysis<sup>[10]</sup></h4> 511 </div> 512 </div> 513 </li> 514 <li> 515 <div class="timeline-badge warning"></div> 516 <div class="timeline-panel"> 517 <div class="timeline-heading"> 518 <h4 class="timeline-title"> <a href="https://www.ncbi.nlm.nih.gov/pubmed/18786398" target="_blank" style="font-size:25px;">2008</a> SAXS-deriverd structure<sup>[11]</sup></h4> 519 </div> 520 </div> 521 </li> 522 <li class="timeline-inverted"> 523 <div class="timeline-badge primary"></div> 524 <div class="timeline-panel"> 525 <div class="timeline-heading"> 526 <h4 class="timeline-title"> <a href="https://www.ncbi.nlm.nih.gov/pubmed/18786398" target="_blank" style="font-size:25px;">2009</a> The soixante-neuf experiment<sup>[12]</sup></h4> 527 </div> 528 </div> 529 </li> 530 <li> 531 <div class="timeline-badge warning"></div> 532 <div class="timeline-panel"> 533 <div class="timeline-heading"> 534 <h4 class="timeline-title"> <a href="https://www.ncbi.nlm.nih.gov/pubmed/20547881" target="_blank" style="font-size:25px;">2010</a> Catalytic mechanism<sup>[13]</sup></h4> 535 </div> 536 </div> 537 </li> 538 <li class="timeline-inverted"> 539 <div class="timeline-badge primary"></div> 540 <div class="timeline-panel"> 541 <div class="timeline-heading"> 542 <h4 class="timeline-title"> <a href="https://www.ncbi.nlm.nih.gov/pubmed/" target="_blank" style="font-size:25px;">2011null</a> Detailed discussion of the chemical mechanism<sup>[14]</sup></h4> 543 </div> 544 </div> 545 </li> 546 <li> 547 <div class="timeline-badge warning"></div> 548 <div class="timeline-panel"> 549 <div class="timeline-heading"> 550 <h4 class="timeline-title"> <a href="https://www.ncbi.nlm.nih.gov/pubmed/26414446" target="_blank" style="font-size:25px;">2015</a> Crystal structure<sup>[18]</sup></h4> 551 </div> 552 </div> 553 </li> 554 <li class="timeline-inverted"> 555 <div class="timeline-badge primary"></div> 556 <div class="timeline-panel"> 557 <div class="timeline-heading"> 558 <h4 class="timeline-title"><a href="https://www.ncbi.nlm.nih.gov/pubmed/31959957" target="_blank" style="font-size:25px;">2020</a> Additional experiments to summarize the structure and function of VS ribozyme<sup>[20]</sup></h4> 559 </div> 560 </div> 561 </li> 562 </ul> 563</html> 564 565<h2 id="description">Description</h2> 566 567<hr /> 568 569<font size="4">Varkud satellite (VS) ribozyme is the largest known nucleolytic ribozyme and found to be embedded in VS RNA. VS RNA is a long non-coding RNA exists as a satellite RNA and is found in mitochondria of Varkud-1C and few other strains of Neurospora. VS ribozyme contains features of both catalytic RNAs and group 1 introns. VS ribozyme has both cleavage and ligation activity and can perform both cleavage and ligation reactions efficie
569ntly in the absence of proteins. VS ribozyme undergo horizontal gene transfer with other Neurospora strains. VS ribozymes have nothing in common with other nucleolytic ribozymes.</font> 570<p><br /></p> 571 572<font size="4">VS RNA has a unique primary, secondary, and tertiary structure. The secondary structure of the VS ribozyme consists of six helical domains. Stem loop I forms the substrate domain while stem-loop II-VI forms the catalytic domain. When these 2 domains are synthesized in vitro separately, they can perform the self-cleavage reaction by trans-acting. The substrate binds into a cleft which is made by two helices. The likely active site of the ribozyme is a very important nucleotide A756. The A730 loop and A756 nucleotide are critical to its function since they participate in the phosphoric transfer chemistry activity of the ribozyme.</font> 573 574<h2 id="structure">Structure and mechanism</h2> 575 576<hr /> 577<blockquote> 578 <p>2D representation</p> 579</blockquote> 580 581<p>Secondary structure of the VS ribozyme, the general acid A756 and general base G638 are shown in red and blue respectively.</p> 582 583<table><tr> 584<td> 585<head> 586 <meta charset="UTF-8" /> 587 <meta http-equiv="X-UA-Compatible" content="IE=edge" /> 588 <meta name="viewport" content="width=device-width, initial-scale=1.0" /> 589 <link rel="stylesheet" href="style.css" /> 590 <title>Document</title> 591</head> 592<style> 593 body { 594 width: 100%; 595 height: 100vh; 596} 597 button { 598 margin-right: 0px; 599} 600 .main-container { 601 display: flex; 602 align-items: left; 603 justify-content: center; 604 height: 100%; 605} 606 .zoom-wrapper1 { 607 width: 460px; 608 height: 400px; 609 border: 1px solid #fff; 610 display: flex; 611 align-items: center; 612 justify-content: center; 613} 614</style> 615 <div class="main-container"> 616 <div class="zoom-wrapper1"> 617 <div class="zoom-area1"> 618 <img src="https://www.ribocentre.org/images/VS_ribozymePic/VS2D.svg" alt="drawing" style="width:150px;height:110px" /> 619 </div> 620 </div> 621 </div> 622
622<script src="https://www.ribocentre.org/js/panzoom.js"></script>
622 623
623<script type="text/javascript"> 624 var zoomWraper1 = document.querySelector(".zoom-wrapper1"); 625 var panzoom1 = Panzoom(document.querySelector(".zoom-area1"), { 626 maxScale: 6 627 }); 628 zoomWraper1.addEventListener("wheel", panzoom1.zoomWithWheel); 629 panzoom1.zoom(300 / document.querySelector(".zoom-area1 img").height); 630 panzoom2.pan(0, 0); 631 </script>
631 632</td> 633<td> 634<link rel="stylesheet" type="text/css" href="https://www.ribocentre.org/css/fornac.css" media="screen" /> 635<div id="custom_colors"></div> 636<form onsubmit="return handleCustomColorApply()" class="optionsform"> 637 <textarea id="CustomColorText" name="hide" textarea="" style="display:none;"> 638 16-19:#036EB8 23-26:#036EB8 34-37:#036EB8 39-43:#036EB8 46-51:#E6A8CA 53-55:#E6A8CA 164-173:#E6A8CA 639 58-63:#FFE945 110-116:#FFE945 640 66-70:#8FC31F 76-80:#8FC31F 83-89:#2EA7E0 97-103:#2EA7E0 117-119:#E60012 122-124:#E60012 126-135:#E60012 641 140-149:#E60012 151:#E60012 153-158:#E60012 1-10:#F39800 175-177:#F39800 179-185:#F39800 642 </textarea> 643</form> 644<meta charset="utf-8" /> 645
645<script type="text/javascript" src="https://www.ribocentre.org/js/jquery.js"></script>
645 646
646<script type="text/javascript" src="https://www.ribocentre.org/js/d3.js"></script>
646 647
647<script type="text/javascript" src="https://www.ribocentre.org/js/demo/rsvfornac.js"></script>
647 648
648<script type="text/javascript"> 649 "use strict" 650 function customColorsContainer() { 651 let container = new fornac.FornaContainer("#custom_colors", 652 {'applyForce': 1,'editable':'true', 'initialSize':[450,400]}); 653 let options = {'structure': '((((((((((.....((((...((((.......))))..))))..((((((.(((..((((((..(((((.....)))))..(((((((.......)))))))......))).)))(((..(((.((((((((((....))))))))))...)))))).....)))))))))..))).)))))))', 654 'sequence': 'GCGCUGUGUCGCAAUCUGCGAAGGGCGUCGUCGGCCCAAGCGGUAGUAAGCAGGGAACUCACCUCCAAUGAAACACAUUGUCGUAGCAGUUGACUACUGUUAUGUGAUUGGUAGAGGCUAAGUGACGGUAUUGGCGUAAGCCAAUACCGCAGCACAGCACAAGCCCGCUUGCGAGAUUACAGCGC' 655 }; 656 container.addRNA(options.structure, options); 657 return container; 658 } 659 let cc = customColorsContainer(); 660 661 function handleCustomColorApply() { 662 cc.addCustomColorsText(document.getElementById("CustomColorText").value); 663 return false; 664 } 665 handleCustomColorApply(); 666 667 </script>
667 668</td> 669</tr></table> 670<p><br /></p> 671 672<blockquote> 673 <p>3D visualisation</p> 674</blockquote> 675<p>Crystal structure of the VS ribozyme, his representation was generated from PDB ID: 4R4V at 3.07Ã resolution. The ribozyme crystallized was a G638A mutant used to prevent self-cleavage occurring during crystallization.</p> 676<table><tr> 677<td><img src="https://www.ribocentre.org/images/VS_ribozymePic/vs3D-1.png" alt="drawing" style="height:345px" border="0" /></td> 678<td> 679 <html lang="en"> 680 <head> 681 <meta charset="utf-8" /> 682 <meta name="viewport" content="width=device-width, user-scalable=no, minimum-scale=1.0, maximum-scale=1.0"> 683 <title>PDBe Molstar - Helper functions</title> 684 685 <!-- Molstar CSS & JS --> 686 <link rel="stylesheet" type="text/css" href="https://www.ebi.ac.uk/pdbe/pdb-component-library/css/pdbe-molstar-3.0.0.css"> 687
687<script type="text/javascript" src="https://www.ebi.ac.uk/pdbe/pdb-component-library/js/pdbe-molstar-plugin-3.0.0.js"></script>
687 688
688<script> 689 function customize() 690 { 691 viewerInstance.canvas.setBgColor({r:255, g:255, b:255}) 692 } 693 </script>
693 694 695 696 <style> 697 * { 698 margin: 0; 699 padding: 0; 700 box-sizing: border-box; 701 } 702 .msp-plugin ::-webkit-scrollbar-thumb { 703 background-color: #474748 !important; 704 } 705 .viewerSection { 706 padding-top: 0px; 707 } 708 .controlsSection { 709 width: 300px; 710 display: flex; 711 float:left; 712 padding: 0px 0 0 0; 713 height:25px; 714 } 715 .controlBox { 716 border: 0px solid lightgray; 717 padding: 0px; 718 margin-bottom: 0px; 719 } 720 #myViewer{ 721 float:left; 722 width:450px; 723 height: 455px; 724 position:relative; 725 } 726 </style> 727 </head> 728 <body onload="customize()"> 729 <div class="controlsSection"> 730 <button onclick=" 731 var selectSections = [ 732 { 733 struct_asym_id: 'A', 734 start_residue_number: 17, 735 end_residue_number: 20, 736 color:{r:24,g:124,b:225}, 737 }, 738 { 739 struct_asym_id: 'A', 740 start_residue_number: 24, 741 end_residue_number: 27, 742 color:{r:24,g:124,b:225} 743 }, 744 { 745 struct_asym_id: 'A', 746 start_residue_number: 35, 747 end_residue_number: 39, 748 color:{r:24,g:124,b:225}, 749 }, 750 { 751 struct_asym_id: 'A', 752 start_residue_number: 41, 753 end_residue_number: 44, 754 color:{r:24,g:124,b:225}, 755 }, 756 { 757 struct_asym_id: 'A', 758 start_residue_number: 47, 759 end_residue_number: 55, 760 color:{r:228,g:148,b:194} 761 }, 762 { 763 struct_asym_id: 'A', 764 start_residue_number: 166, 765 end_residue_number: 173, 766 color:{r:228,g:148,b:194} 767 }, 768 { 769 struct_asym_id: 'A', 770 start_residue_number: 59, 771 end_residue_number: 64, 772 color:{r:235,g:204,b:86} 773 }, 774 { 775 struct_asym_id: 'A', 776 start_residue_number: 111, 777 end_residue_number: 117, 778 color:{r:235,g:204,b:86} 779 }, 780 { 781 struct_asym_id: 'A', 782 start_residue_number: 67, 783 end_residue_number: 71, 784 color:{r:5,g:225,b:5} 785 }, 786 { 787 struct_asym_id: 'A', 788 start_residue_number: 77, 789 end_residue_number: 81, 790 color:{r:5,g:225,b:5} 791 }, 792 { 793 struct_asym_id: 'A', 794 start_residue_number: 84, 795 end_residue_number: 90, 796 color:{r:6,g:241,b:241} 797 }, 798 { 799 struct_asym_id: 'A', 800 start_residue_number: 98, 801 end_residue_number: 104, 802 color:{r:6,g:241,b:241} 803 }, 804 { 805 struct_asym_id: 'A', 806 start_residue_number: 118, 807 end_residue_number: 120, 808 color:{r:219,g:0,b:0} 809 }, 810 { 811 struct_asym_id: 'A', 812 start_residue_number: 123, 813 end_residue_number: 125, 814 color:{r:219,g:0,b:0} 815 }, 816 { 817 struct_asym_id: 'A', 818 start_residue_number: 127, 819 end_residue_number: 136, 820 color:{r:219,g:0,b:0} 821 }, 822 { 823 struct_asym_id: 'A', 824 start_residue_number: 141, 825 end_residue_number: 150, 826 color:{r:219,g:0,b:0} 827 }, 828 { 829 struct_asym_id: 'A', 830 start_residue_number: 152, 831 end_residue_number: 152, 832 color:{r:219,g:0,b:0} 833 }, 834 { 835 struct_asym_id: 'A', 836 start_residue_number: 154, 837 end_residue_number: 159, 838 color:{r:219,g:0,b:0} 839 }, 840 { 841 struct_asym_id: 'A', 842 start_residue_number: 1, 843 end_residue_number: 11, 844 color:{r:250,g:201,b:153} 845 }, 846 { 847 struct_asym_id: 'A', 848 start_residue_number: 176, 849 end_residue_number: 178, 850 color:{r:250,g:201,b:153} 851 }, 852 { 853 struct_asym_id: 'A', 854 start_residue_number: 180, 855 end_residue_number: 186, 856 color:{r:250,g:201,b:153} 857 } 858 ] 859 viewerInstance.visual.select({ data: selectSections, nonSelectedColor: {r:255,g:255,b:255}})" style="float:right;height:25px;">Color Selection</button><br><br> 860 861 <button button style="float: left;height:25px;" onclick="viewerInstance.visual.clearSelection()">Clear Selection</button><br><br> 862 863 </div> 864
865 <div class="viewerSection"> 866 867 <!-- Molstar container --> 868 <div id="myViewer"></div> 869 870 </div> 871
871<script> 872 873 //Create plugin instance 874 var viewerInstance = new PDBeMolstarPlugin(); 875 876 //Set options (Checkout available options list in the documentation) 877 var options = { 878 moleculeId: '4r4v', 879 hideControls: true 880 } 881 882 //Get element from HTML/Template to place the viewer 883 var viewerContainer = document.getElementById('myViewer'); 884 885 //Call render method to display the 3D view 886 viewerInstance.render(viewerContainer, options); 887 888 </script>
888 889 </body> 890</html></td> 891</tr></table> 892<p><br /></p> 893 894<blockquote> 895 <p>Catalytic centre</p> 896</blockquote> 897<p>The active center of the ribozyme, he key catalytic participants are the nucleobases of G638 (replaced by adenine in this structure) and A756, the general base and acid, respectively, in the cleavage reaction (PDB ID: 4R4V).<br> 898 Schematic of biochemically inferred mechanism of catalysis by the VS ribozyme involving general acid-base catalysis by G638 and A756. Arrows indicate bonds that are formed or broken during the transition state. 899</p> 900 901<table><tr> 902<td><img src="https://www.ribocentre.org/images/VS_ribozymePic/vs-m1.png" alt="drawing" style="weight:600px;height:370px" border="0" /></td> 903<td><img src="https://www.ribocentre.org/images/VS_ribozymePic/vs-m21.png" alt="drawing" style="weight:450px;height:227px" border="0" /></td> 904</tr></table> 905<p><br /><br /></p> 906 907<blockquote> 908 <p>Chemical mechanism</p> 909</blockquote> 910 911<p>The VS ribozyme employs general acid-base catalysis, using the nucleobases of G638 (in its deprotonated form)<sup>[10]</sup> as general base to remove the proton from the 2â-OH nucleophile and A756 (in its protonated form)<sup>[4,7]</sup> as the general acid to protonate the leaving group. The pH - rate profile for the VS ribozyme is bell shaped, fitting pKa values of 5.2 and 8.4 corresponding to A756 and G638 respectively <sup>[10]</sup>. The acid and base were assigned by 5â-phosphorothiolate substitution experiments <sup>[13]</sup>. The pH dependence of a VS G638DAP ribozyme cleavage reaction indicated that proton transfer contributes at least 102-103 fold to the catalytic power of the ribozyme<sup>[10]</sup>. When the crystal structure of the VS ribozyme was eventually solved it was found that G638 and A756 were adjacent to the O2â and O5â atoms respectively, consistent with their proposed roles in catalysis<sup>[18]</sup>. Note that despite different overall RNA folds, the catalytic mechanisms of the VS and hairpin ribozymes are closely similar, both using G (general base) + A (general acid) mechanisms.</p> 912 913<h2 id="references">References</h2> 914 915<hr /> 916 917<p><strong>[1] A site-specific self-cleavage reaction performed by a novel RNA in neurospora mitochondria.</strong><br />
918Saville, B. J. and R. A. Collins <br /> 919<a href="https://www.ncbi.nlm.nih.gov/pubmed/2160856" target="_blank">Cell 61(4): 685-696.(1990)</a><br /><br /></p> 920 921<p><strong>[2] A secondary-structure model for the self-cleaving region of Neurospora VS RNA.</strong><br /> 922Beattie, T. L., J. E. Olive and R. A. Collins <br /> 923<a href="https://www.ncbi.nlm.nih.gov/pubmed/7753865" target="_blank">Proc Natl Acad Sci U S A 92(10): 4686-4690.(1995)</a><br /><br /></p> 924 925<p><strong>[3] Structure, folding and activity of the VS ribozyme : Importance of the 2-3-6 helical junction</strong><br /> 926D.A. Lafontaine, D.G. Norman and D.M.J. Lilley <br /> 927<a href="https://www.ncbi.nlm.nih.gov/pubmed/11250907" target="_blank">EMBO J. 20 1415-1424 (2001)</a><br /><br /></p> 928 929<p><strong>[4] The A730 loop is an important component of the active site of the VS ribozyme.</strong><br /> 930Lafontaine, D. A., T. J. Wilson, D. G. Norman and D. M. Lilley <br /> 931<a href="https://www.ncbi.nlm.nih.gov/pubmed/11575922" target="_blank">J Mol Biol 312(4): 663-674.(2001)</a><br /><br /></p> 932 933<p><strong>[5] A pH controlled conformational switch in the cleavage site of the VS ribozyme substrate RNA.</strong><br /> 934Flinders, J. and T. Dieckmann <br /> 935<a href="https://www.ncbi.nlm.nih.gov/pubmed/11350168" target="_blank">J Mol Biol 308(4): 665-679.(2001)</a><br /><br /></p> 936 937<p><strong>[6] The global structure of the VS ribozyme.</strong><br /> 938D.A. Lafontaine, D.G. Norman and D. M.J. Lilley<br /> 939<a href="https://www.ncbi.nlm.nih.gov/pubmed/nan" target="_blank">EMBO J. 21, 2461-2471(2002)</a><br /><br /></p> 940 941<p><strong>[7] Functional Group Requirements in the Probable Active Site of the VS Ribozyme.</strong><br /> 942Lafontaine, D. A., T. J. Wilson, Z.-Y. Zhao and D. M. J. Lilley <br /> 943<a href="https://www.ncbi.nlm.nih.gov/pubmed/12368096" target="_blank">Journal of Molecular Biology 323(1): 23-34.(2002)</a><br /><br /></p> 944 945<p><strong>[8] Efficient, pH-dependent RNA ligation by the VS ribozyme in trans</strong><br /> 946A.C. McLeod and D.M.J. Lilley<br /> 947<a href="https://www.ncbi.nlm.nih.gov/pubmed/nan" target="_blank">Biochemistry 43, 1118 â 1125(2004)</a><br /><br /></p> 948 949<p><strong>[9] Nuclear magnetic resonance structure of the Varkud satellite ribozyme stem-loop V RNA and magnesium-ion binding from chemical-shift mapping.</strong><br /> 950Campbell, D. O. and P. Legault <br /> 951<a href="https://www.ncbi.nlm.nih.gov/pubmed/15766243" target="_blank">Biochemistry 44(11): 4157-4170.(2005)</a><br /><br /></p> 952 953<p><strong>[10] A guanine nucleobase important for catalysis by the VS ribozyme.</strong><br /> 954Wilson, T. J., A. C. McLeod and D. M. Lilley<br /> 955<a href="https://www.ncbi.nlm.nih.gov/pubmed/17464286" target="_blank">EMBO J 26(10): 2489-2500.(2007)</a><br /><br /></p> 956 957<p><strong>[11] The complete VS ribozyme in solution studied by small-angle X-ray scattering.</strong><br /> 958Lipfert, J., J. Ouellet, D. G. Norman, S. Doniach and D. M. Lilley <br /> 959<a href="https://www.ncbi.nlm.nih.gov/pubmed/18786398" target="_blank">Structure 16(9): 1357-1367.(2008)</a><br /><br /></p> 960 961<p><strong>[12] Formation of an active site in trans by interaction of two complete Varkud Satellite ribozymes</strong><br /> 962J. Ouellet, M. Byrne and D. M. J. Lilley<br /> 963<a href="https://www.ncbi.nlm.nih.gov/pubmed/19703941" target="_blank">RNA 15, 1822-1826(2009)</a><br /><br /></p> 964 965<p><strong>[13] Nucleobase-mediated general acid-base catalysis in the Varkud satellite ribozyme.</strong><br /> 966Wilson, T. J., N. S. Li, J. Lu, J. K. Frederiksen, J. A. Piccirilli and D. M. Lilley<br /> 967<a href="https://www.ncbi.nlm.nih.gov/pubmed/20547881" target="_blank">Proc Natl Acad Sci U S A 107(26): 11751-11756.(2010)</a><br /><br /></p> 968 969<p><strong>[14] Do the hairpin and VS ribozymes share a common catalytic mechanism based on general acid-base catalysis ? A critical assessment of available experimental data.</strong><br /> 970T. J. Wilson and D. M. J. Lilley. <br /> 971<a href="https://www.ncbi.nlm.nih.gov/pubmed/21173201" target="_blank">RNA 17, 213-221 (2011)</a><br /><br /></p> 972 973<p><strong>[15] NMR structure of the A730 loop of the Neurospora VS ribozyme: insights into the formation of the active site.</strong><br /> 974Desjardins, G., E. Bonneau, N. Girard, J. Boisbouvier and P. Legault <br /> 975<a href="https://www.ncbi.nlm.nih.gov/pubmed/21266483" target="_blank">Nucleic Acids Res 39(10): 4427-4437.(2011)</a><br /><br /></p> 976 977<p><strong>[16] Nuclear magnetic resonance structure of the III-IV-V three-way junction from the Varkud satellite ribozyme and identification of magnesium-binding sites using paramagnetic relaxation enhancement.</strong><br /> 978Bonneau, E. and P. Legault <br /> 979<a href="https://www.ncbi.nlm.nih.gov/pubmed/25238589" target="_blank">
979Biochemistry 53(39): 6264-6275.(2014)</a><br /><br /></p> 980 981<p><strong>[17] The NMR structure of the II-III-VI three-way junction from the Neurospora VS ribozyme reveals a critical tertiary interaction and provides new insights into the global ribozyme structure.</strong><br /> 982Bonneau, E., N. Girard, S. Lemieux and P. Legault <br /> 983<a href="https://www.ncbi.nlm.nih.gov/pubmed/26124200" target="_blank">RNA 21(9): 1621-1632.(2015)</a><br /><br /></p> 984 985<p><strong>[18] Crystal structure of the Varkud satellite ribozyme.</strong><br /> 986Suslov, N. B., S. DasGupta, H. Huang, J. R. Fuller, D. M. Lilley, P. A. Rice and J. A. Piccirilli <br /> 987<a href="https://www.ncbi.nlm.nih.gov/pubmed/26414446" target="_blank">Nat Chem Biol 11(11): 840-846.(2015)</a><br /><br /></p> 988 989<p><strong>[19] Structural Basis for Substrate Helix Remodeling and Cleavage Loop Activation in the Varkud Satellite Ribozyme.</strong><br /> 990DasGupta, S., N. B. Suslov and J. A. Piccirilli <br /> 991<a href="https://www.ncbi.nlm.nih.gov/pubmed/28625058" target="_blank">J Am Chem Soc 139(28): 9591-9597.(2017)</a><br /><br /></p> 992 993<p><strong>[20] Confluence of theory and experiment reveals the catalytic mechanism of the Varkud satellite ribozyme.</strong><br /> 994Ganguly, A., B. P. Weissman, T. J. Giese, N. S. Li, S. Hoshika, S. Rao, S. A. Benner, J. A. Piccirilli and D. M. York <br /> 995<a href="https://www.ncbi.nlm.nih.gov/pubmed/31959957" target="_blank">Nat Chem 12(2): 193-201.(2020)</a><br /><br /></p> 996 997 998 </div> 999 1000</article> 1001 1002 </div> 1003 </div> 1004 1005 <div id="footer" class="panel"> 1006 <div class="panel-footer" style='background-color: #333333; color: #eeeeee;'> 1007 <div class="container-fluid"> 1008 <div class="row"> 1009 <div class="col-sm-4"> 1010 1011 <p>© 2024 GZNL-RDC. </p> 1012 <p>We are part of the <a href="https://gzlab.ac.cn">Guangzhou Laboratory</a> and <a href="http://www.rnacentre.org/">RNAcentre</a> and <a href="http://www.gzsys.org.cn/">Sun Yat-sen University</a>.</p> 1013 <p>Site made with <a href="https://jekyllrb.com">Jekyll</a>; <a href="{{ site.url }}{{ site.baseurl }}/aboutwebsite.html">copy and modify it for your own research group</a>.</p> 1014 <p> </p> 1015 <p> </p> 1016 </div> 1017 1018 <div class="col-sm-4"> 1019 Funding:<br /> 1020 - <a href="https://gzlab.ac.cn">R&D Programs of Guangzhou Laboratory</a><br /> 1021 - <a href="http://www.most.gov.cn/">MOST IT+BT projects</a> <br /> 1022 - <a href="https://www.nsfc.gov.cn/">NSFC</a> <br /> 1023 <br> 1024
1024<script async src="//busuanzi.ibruce.info/busuanzi/2.3/busuanzi.pure.mini.js"></script>
1024 1025 <!--<span class="glyphicon glyphicon-user"></span> <span id="busuanzi_container_site_uv"><strong>: <a href=""><span id="busuanzi_value_site_uv"></span></strong></a> </span> 1026 !--><span class="glyphicon glyphicon-eye-open"></span> <span id="busuanzi_container_site_pv">: <a href="" ><span id="busuanzi_value_site_pv"></span></a> </span> 1027 </div> 1028 1029 <div class="col-sm-4"> 1030 Contact:<br /> 1031 Building B2, Guangzhou National Laboratory<br /> 1032 96 Xingdao South Road, Guangzhou International Bio Island, <br /> 1033 Haizhu District, Guangzhou, Guangdong, China.<br /> 1034 (<a href="https://goo.gl/maps/hDLr6siEAS2Eaypt8">Maps</a>) 1035 </div> 1036 </div> 1037 </div> 1038 </div> 1039 </div> 1040 1041
1041<script src="https://ajax.googleapis.com/ajax/libs/jquery/1.11.3/jquery.min.js"></script>
1041 1042
1042<script src="{{ site.url }}{{ site.baseurl }}/js/bootstrap.min.js"></script>
1042 1043 1044 </body> 1045 1046</html>
Line numbers count LF bytes from the start of the resource, as the search results do. Vendor segments are library code the classifier recognised; they are stored but not indexed. Bytes are shown as Latin1 characters, one per byte.